Orphea Home page

Download Orphea

Windows 32bits Version (Jan. 22, 2015)

MacIntosh x86_64 Version (Feb. 24, 2014)

Linux i686 (32 bits) Version (Jan. 22, 2015)

Linux x86_64 Version (Jan. 22, 2015)

Orphea manual page

Synopsis:

orphea [-1] [-s] [-i pattern] [-x pattern] [-r] [-c cds_file] [-o output file]
FASTA_input_file [ARFF output file]

-1: [Linux and MacOSX] use only one thread (the default behaviour is to use as many threads as there are slippery sequences).
-s: don't search for stop codon in -1 phase in the 200 nucleotides following the slippery sequence.
-i pattern: include only the sequences where 'pattern' is found in the fasta header.
-x pattern: exclude the sequences where 'pattern' is found in the fasta header.
-r: PK are not searched in the reverse complementary sequence (the default behaviour is to search both the direct and reverse complementary strands)
-c cds-file: use a GenBank format CDS file to find if a PK is found in a coding sequence
-o file: output the results in file. The output default filename is input_filename-out.txt

Input:

The input file can be a FASTA format file, a concatenation of many FASTA files; Using plain text or compressed with gzip.

Output:

The output file summarises the pseudo-knots found that are good candidates for FS-1. They are first searched in the direct strand (the input sequence) then, unless the -r switch is used, in the reverse complementary sequence.

The output looks like this:

NC_00003 S.cerevisiae synthetised genome, 12000000 bases
Direct strand
cand_1:
        offset: 10297906 scores: stem1 = 157, stem2 = 38
GGGAAAUUUGAGUGGAUUCACGAAAUGAAUCCACCUCUUGGAUAUGUAAAAAUGGUGCCG
*******....((((((((([[...)))))))))........................]]

...

cand_42:
	offset: 6869568 scores: stem1 = 124, stem2 = 52
UUUUUUUCAACUUACAAAUCUGGAUCCACUUCCAGAUUUUUCAAGAAUUAUUUAUCCAAAUUGGA
*******........((((((((([[[[..)))))))))......................]]]]

Reverse complement
cand_43:
	offset: 1891213 scores: stem1 = 129, stem2 = 82
GGGAAAACCCUUCCGAGGGCAAUUCCUCAACCGUGCUUCUCUAUAAAGGCCCAGGAAUCUACAAAUAACACGG
*******.........((((..........[[[[[.............))))................]]]]]

...

cand_102:
        offset: 10654018 scores: stem1 = 152, stem2 = 51
UUUUUUUCUCUUCACGGCGCUCUAAGUUUGAUUGGCCCAAACAUUCAUACGCCGUUGAACACCUUGUUGGACUUCAGAC
*******......((((((......[[[[[[..................))))))..................]]]]]]

-------------------------------------------------------------------------------

102 PK found.

where ``cand_NNN'' means FS-1 candidate number NNN, ``offset'' is the location in the input sequence where the PK has been found, the scores are those found for each stem.

The candidate sequence is output starting from the slippery sequence up to the last base of the second stem. The pairings are shown in the next line, using the bracket/parenthesis notation.

This website is maintained by Patrick AMAR (pa{AT}lri{DOT}fr)